Sample ID: VE24-1086_COI
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:10 |
| Analysis completed | 2025-05-03 01:28:10 |
| Wall time | 0:0:0 hours |
Inconclusive
Outcome: The analyst should attempt subjective species identification at the genus level.
Reasoning: [Flag 1D] At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%).
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1D) Tortricidae. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
No GBIF record found for 'Tortricidae sp. NIBGE MOT-03651'. Taxonomic records cannot be retrieved for this species name - please check that this species name is correct.
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis.
| Taxa of interest detected? | False |
|
Flag 2B: Taxon of interest NOT detected in candidate species Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2B: 10-90% of related taxa have reference sequence(s) at the given locus |
|
| Locus | COI |
| Preliminary ID | Tortricidae |
| Taxa of interest |
Archips machlopis |
| Country | Malaysia |
| Host | Cut flower Orchidaceae |
| Sample ID | VE24-1086_COI |
| Query DNA sequence |
>VE24-1086_COI TACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACTTCTTTAAGTTTATT AATTCGAGCAGAATTAGGTAACCCAGGATCTTTAATCGGAGACGATCAAATTTATAATAC TATTGTCACAGCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGG AGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGACATAGCTTTCCCCCG TATAAATAACATAAGATTTTGACTTTTACCCCCCTCTCTTATACTTTTAATTTCTAGAAG AATTGTAGAAAATGGAGCCGGTACAGGATGAACAGTTTACCCCCCACTTTCATCTAATAT TGCTCATAGCGGTAGATCAGTAGATTTAGCAATTTTCTCTTTACATTTAGCAGGAATTTC ATCAATCTTAGGAGCTGTAAATTTTATTACAACTATTATTAATATACGACCTAATCATAT ATCTTTAGACCAAATACCTTTATTTGTATGAGCTGTAGGAATCACAGCTTTATTACTTTT ACTATCTTTACCCGTTTTAGCAGGAGCTATTACTATATTATTAACCGATCGAAATTTAAA TACTTCATTTTTTGATCCTGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTT
Flag 1D:
The analyst should attempt subjective species identification at the genus level
At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 0 | 0 |
| MODERATE MATCH | ≥ 93.5% | 1 | 1 |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Tortricidae sp. NIBGE MOT-03651 | 1 | 94.1% | 0.0 |
Database coverage of Candidate Tortricidae sp. NIBGE MOT-03651This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis. |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | KX861718 | Tortricidae sp. NIBGE MOT-03651 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 995.588 | 0.00e+00 | 94.1% |
| 2 | OQ563571 | Choristoneura hebenstreitella voucher INV01069 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 940.085 | 0.00e+00 | 93.0% |
| 3 | GU706517 | Archips crataeganus voucher BC ZSM Lep 23124 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 932.156 | 0.00e+00 | 92.9% |
| 4 | KX043918 | Choristoneura hebenstreitella voucher UKLB38B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 932.156 | 0.00e+00 | 92.9% |
| 5 | KT782384 | Archips crataeganus voucher MM19904 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 932.156 | 0.00e+00 | 92.9% |
| 6 | JF859735 | Choristoneura hebenstreitella voucher TLMF Lep 02151 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 932.156 | 0.00e+00 | 92.9% |
| 7 | OX402076 | Archips crataeganus genome assembly, organelle: mitochondrion | 658 | 100.0% | 932.156 | 0.00e+00 | 92.9% |
| 8 | KX049183 | Archips crataeganus voucher NHMO-07031 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 930.173 | 0.00e+00 | 92.8% |
| 9 | KM544475 | Choristoneura lambertiana voucher 08BBLEP-05025 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 922.244 | 0.00e+00 | 92.7% |
| 10 | KM545821 | Choristoneura pinus voucher 08BBLEP-04380 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 94.2% | 872.688 | 0.00e+00 | 92.7% |
| 11 | KR450013 | Choristoneura sp. BOLD:ABX5883 voucher BIOUG12400-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 599 | 91.0% | 838.989 | 0.00e+00 | 92.7% |
| 12 | KM551985 | Choristoneura sp. BOLD:ABX5883 voucher BIOUG06608-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 599 | 91.0% | 838.989 | 0.00e+00 | 92.7% |
| 13 | KM545019 | Choristoneura sp. BOLD:ABX5883 voucher BIOUG04118-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 94.2% | 864.759 | 0.00e+00 | 92.6% |
| 14 | HQ106911 | Choristoneura fumiferana voucher EE-4196-89 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 657 | 99.8% | 916.298 | 0.00e+00 | 92.5% |
| 15 | GU096705 | Choristoneura fumiferana voucher BIOUG| 657 |
99.8% |
914.315 |
0.00e+00 |
92.5% |
|
| 16 | KX040512 | Choristoneura hebenstreitella voucher BC ZSM Lep 50707 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 908.369 | 0.00e+00 | 92.4% |
| 17 | PV198740 | Archips crataeganus voucher 2889 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 908.369 | 0.00e+00 | 92.4% |
| 18 | JF703053 | Choristoneura hebenstreitella voucher JDDNA4535 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 908.369 | 0.00e+00 | 92.4% |
| 19 | PV198840 | Archips crataeganus voucher 3016 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 908.369 | 0.00e+00 | 92.4% |
| 20 | HQ106905 | Choristoneura fumiferana voucher EE-4387-89 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 657 | 99.8% | 908.369 | 0.00e+00 | 92.4% |
| 21 | L19095 | Choristoneura pinus cytochrome oxidase I (COI) gene, complete cds; tRNA-Leu (trnL) gene, complete sequence; and cytochrome oxidase II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 22 | NC_039422 | Choristoneura pinus pinus mitochondrion, complete genome | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 23 | KM548264 | Choristoneura occidentalis voucher 08BBLEP-02301 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 24 | GU690211 | Choristoneura fumiferana voucher BIOUG| 657 |
99.8% |
906.386 |
0.00e+00 |
92.4% |
|
| 25 | HM863981 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-2231 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 26 | GU096706 | Choristoneura fumiferana voucher BIOUG| 657 |
99.8% |
906.386 |
0.00e+00 |
92.4% |
|
| 27 | MT711509 | Choristoneura fumiferana voucher Sperling lab #399 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 28 | NC_037395 | Choristoneura fumiferana mitochondrion, complete genome | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 29 | KX049738 | Choristoneura hebenstreitella voucher NHMO-08057 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 30 | MT711515 | Choristoneura pinus voucher Sperling lab #pNA cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 31 | MT711307 | Choristoneura lambertiana voucher GF_FS_7473coi cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 32 | L19098 | Choristoneura fumiferana cytochrome oxidase I (COI) gene, complete cds; tRNA-Leu (trnL) gene, complete sequence; and cytochrome oxidase II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 33 | MG932647 | Choristoneura fumiferana mitochondrion, complete genome | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 34 | HQ106903 | Choristoneura fumiferana voucher EE-4075-89 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 35 | FJ412301 | Choristoneura occidentalis voucher UBC-2007-0827 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 36 | LT999974 | Choristoneura fumiferana genome assembly, organelle: mitochondrion | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 37 | KM547457 | Choristoneura fumiferana voucher 08BBLEP-01628 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 38 | MZ636560 | Clepsis pallidana mitochondrion, complete genome | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 39 | KT137334 | Choristoneura pinus voucher HLC-22601 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 906.386 | 0.00e+00 | 92.4% |
| 40 | GU093109 | Choristoneura fumiferana voucher BIOUG| 657 |
99.8% |
906.386 |
0.00e+00 |
92.4% |
|
| 41 | HM415222 | Choristoneura fumiferana voucher BIOUG| 656 |
99.7% |
904.404 |
0.00e+00 |
92.4% |
|
| 42 | HQ106904 | Choristoneura fumiferana voucher EE-4156-89 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 654 | 99.4% | 900.439 | 0.00e+00 | 92.4% |
| 43 | KM542217 | Choristoneura pinus voucher 08BBLEP-03372 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 97.4% | 882.599 | 0.00e+00 | 92.4% |
| 44 | KM539742 | Choristoneura fumiferana voucher 08BBLEP-01646 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 635 | 96.5% | 878.635 | 0.00e+00 | 92.4% |
| 45 | KM546096 | Choristoneura conflictana voucher BIOUG03016-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 874.67 | 0.00e+00 | 92.4% |
| 46 | HM436000 | Choristoneura fumiferana voucher BIOUG| 632 |
96.0% |
872.688 |
0.00e+00 |
92.4% |
|
| 47 | KR452892 | Choristoneura sp. BOLD:ABX5883 voucher BIOUG10280-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 95.9% | 870.706 | 0.00e+00 | 92.4% |
| 48 | KM542883 | Choristoneura fumiferana voucher 08BBLEP-01634 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 95.9% | 870.706 | 0.00e+00 | 92.4% |
| 49 | KM540859 | Choristoneura conflictana voucher BIOUG03754-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 868.723 | 0.00e+00 | 92.4% |
| 50 | HM436031 | Choristoneura fumiferana voucher BIOUG| 629 |
95.6% |
866.741 |
0.00e+00 |
92.4% |
|
| 51 | KM555028 | Choristoneura fumiferana voucher 08BBLEP-04375 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 94.2% | 856.83 | 0.00e+00 | 92.4% |
| 52 | GU093108 | Choristoneura fumiferana voucher BIOUG| 616 |
93.6% |
848.901 |
0.00e+00 |
92.4% |
|
| 53 | MN565333 | Clepsis pallidana isolate 20160110 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 615 | 93.5% | 846.918 | 0.00e+00 | 92.4% |
| 54 | GU096710 | Choristoneura fumiferana voucher BIOUG| 652 |
99.1% |
896.475 |
0.00e+00 |
92.3% |
|
| 55 | KT129803 | Choristoneura fumiferana voucher 06-PROBE-2793 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 98.8% | 892.51 | 0.00e+00 | 92.3% |
| 56 | GU096716 | Choristoneura fumiferana voucher BIOUG| 649 |
98.6% |
890.528 |
0.00e+00 |
92.3% |
|
| 57 | HM414816 | Choristoneura fumiferana voucher BIOUG| 649 |
98.6% |
890.528 |
0.00e+00 |
92.3% |
|
| 58 | KM546191 | Choristoneura fumiferana voucher 08BBLEP-04312 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 96.7% | 872.688 | 0.00e+00 | 92.3% |
| 59 | HM427401 | Choristoneura houstonana voucher BIOUG| 636 |
96.7% |
872.688 |
0.00e+00 |
92.3% |
|
| 60 | KT141997 | Choristoneura pinus voucher HLC-22695 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 96.7% | 872.688 | 0.00e+00 | 92.3% |
| 61 | KM539933 | Choristoneura conflictana voucher BIOUG03016-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 866.741 | 0.00e+00 | 92.3% |
| 62 | KM539726 | Choristoneura conflictana voucher BIOUG03045-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 866.741 | 0.00e+00 | 92.3% |
| 63 | KM545319 | Choristoneura conflictana voucher BIOUG03547-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 866.741 | 0.00e+00 | 92.3% |
| 64 | KM542021 | Choristoneura conflictana voucher BIOUG03016-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 866.741 | 0.00e+00 | 92.3% |
| 65 | KM551130 | Choristoneura fumiferana voucher 08BBLEP-04383 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 94.2% | 850.883 | 0.00e+00 | 92.3% |
| 66 | KM549149 | Choristoneura conflictana voucher BIOUG04476-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 94.4% | 850.883 | 0.00e+00 | 92.3% |
| 67 | KM540271 | Choristoneura conflictana voucher BIOUG03128-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 94.4% | 850.883 | 0.00e+00 | 92.3% |
| 68 | KM540256 | Choristoneura conflictana voucher BIOUG03128-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 94.4% | 850.883 | 0.00e+00 | 92.3% |
| 69 | HQ682793 | Choristoneura occidentalis group sp. JRD-2011 voucher 08-JDWBC-2444 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 94.2% | 848.901 | 0.00e+00 | 92.3% |
| 70 | KM540089 | Choristoneura pinus voucher 08BBLEP-04270 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 94.2% | 848.901 | 0.00e+00 | 92.3% |
| 71 | KM554866 | Choristoneura conflictana voucher BIOUG03045-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 94.2% | 848.901 | 0.00e+00 | 92.3% |
| 72 | GU095668 | Choristoneura fumiferana voucher jflandry0604 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 902.422 | 0.00e+00 | 92.2% |
| 73 | KF396723 | Planostocha sp. ANIC1 voucher 11ANIC-10727 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 900.439 | 0.00e+00 | 92.2% |
| 74 | KT127181 | Choristoneura fumiferana voucher 2006-ONT-1231 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 900.439 | 0.00e+00 | 92.2% |
| 75 | HQ106912 | Choristoneura fumiferana voucher EE-4220-89 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 657 | 99.8% | 900.439 | 0.00e+00 | 92.2% |
| 76 | KM549359 | Choristoneura parallela voucher 08BBLEP-01719 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 900.439 | 0.00e+00 | 92.2% |
| 77 | KP850299 | Tortricidae sp. BOLD:ACM3136 voucher USNM ENT 00795383 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 900.439 | 0.00e+00 | 92.2% |
| 78 | KM543592 | Choristoneura conflictana voucher 08BBLEP-01626 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 900.439 | 0.00e+00 | 92.2% |
| 79 | PV198821 | Archips crataeganus voucher 2989 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 900.439 | 0.00e+00 | 92.2% |
| 80 | MT711514 | Choristoneura luticostana voucher Sperling lab #10108 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 900.439 | 0.00e+00 | 92.2% |
| 81 | HQ106921 | Choristoneura fumiferana voucher EE-18167-85 P1 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 657 | 99.8% | 900.439 | 0.00e+00 | 92.2% |
| 82 | GU699097 | Lepidoptera sp. BOLD:AAA1008 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 900.439 | 0.00e+00 | 92.2% |
| 83 | GU438801 | Choristoneura fumiferana voucher BIOUG| 657 |
99.8% |
898.457 |
0.00e+00 |
92.2% |
|
| 84 | FJ412287 | Choristoneura occidentalis voucher UBC-2007-0465 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 85 | GU096700 | Choristoneura fumiferana voucher BIOUG| 657 |
99.8% |
898.457 |
0.00e+00 |
92.2% |
|
| 86 | GU096707 | Choristoneura fumiferana voucher BIOUG| 657 |
99.8% |
898.457 |
0.00e+00 |
92.2% |
|
| 87 | HM415927 | Choristoneura fumiferana voucher BIOUG| 657 |
99.8% |
898.457 |
0.00e+00 |
92.2% |
|
| 88 | FJ412284 | Choristoneura occidentalis voucher UBC-2007-0455 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 89 | MT711305 | Choristoneura occidentalis voucher GF_FS_OCCNA cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 90 | JF852866 | Choristoneura sp. LALPA431-10 voucher BIOUG| 657 |
99.8% |
898.457 |
0.00e+00 |
92.2% |
|
| 91 | HM415211 | Choristoneura fumiferana voucher BIOUG| 657 |
99.8% |
898.457 |
0.00e+00 |
92.2% |
|
| 92 | DQ792586 | Choristoneura orae voucher FSb216 cytochrome oxidase subunit I (COI) gene, complete cds; tRNA-Leu gene, complete sequence; and cytochrome oxidase subunit II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 93 | KM551158 | Choristoneura occidentalis voucher 08BBLEP-02346 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 94 | MT711510 | Choristoneura murinana voucher Sperling lab #10146 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 95 | NC_037393 | Choristoneura occidentalis mitochondrion, complete genome | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 96 | HQ682807 | Choristoneura occidentalis group sp. JRD-2011 voucher 08-JDWBC-3117 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 97 | FJ412285 | Choristoneura occidentalis voucher UBC-2007-0467 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 98 | HQ106910 | Choristoneura fumiferana voucher EE-4153-89 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 99 | HQ682799 | Choristoneura occidentalis group sp. JRD-2011 voucher 08-JDWBC-3110 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 100 | KM548278 | Choristoneura pinus voucher 08BBLEP-03571 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 101 | BT070772 | Picea sitchensis clone WS0274_C01 unknown mRNA | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 102 | KT130551 | Choristoneura pinus voucher HLC-22507 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 898.457 | 0.00e+00 | 92.2% |
| 103 | KM546567 | Choristoneura fumiferana voucher 08BBLEP-04280 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 896.475 | 0.00e+00 | 92.2% |
| 104 | KM544344 | Choristoneura fumiferana voucher 08BBLEP-01610 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 894.493 | 0.00e+00 | 92.2% |
| 105 | GU096704 | Choristoneura fumiferana voucher BIOUG| 653 |
99.2% |
892.51 |
0.00e+00 |
92.2% |
|
| 106 | GU096714 | Choristoneura fumiferana voucher BIOUG| 652 |
99.1% |
890.528 |
0.00e+00 |
92.2% |
|
| 107 | KT135500 | Choristoneura pinus voucher HLC-23688 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 99.1% | 888.546 | 0.00e+00 | 92.2% |
| 108 | KT147059 | Choristoneura conflictana voucher 08BBLEP-00801 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 98.9% | 886.564 | 0.00e+00 | 92.2% |
| 109 | GU096713 | Choristoneura fumiferana voucher BIOUG| 651 |
98.9% |
886.564 |
0.00e+00 |
92.2% |
|
| 110 | KM546021 | Choristoneura conflictana voucher 08BBLEP-01005 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 98.9% | 886.564 | 0.00e+00 | 92.2% |
| 111 | KM545190 | Choristoneura fumiferana voucher 08BBLEP-01642 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 643 | 97.7% | 878.635 | 0.00e+00 | 92.2% |
| 112 | KM543957 | Choristoneura occidentalis voucher 08BBLEP-03391 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 97.3% | 872.688 | 0.00e+00 | 92.2% |
| 113 | KM547255 | Choristoneura conflictana voucher BIOUG03045-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 97.0% | 868.723 | 0.00e+00 | 92.2% |
| 114 | KR941523 | Choristoneura conflictana voucher BIOUG18092-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 864.759 | 0.00e+00 | 92.2% |
| 115 | KM540036 | Choristoneura conflictana voucher BIOUG03045-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 864.759 | 0.00e+00 | 92.2% |
| 116 | KM547952 | Choristoneura occidentalis voucher 08BBLEP-03363 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 864.759 | 0.00e+00 | 92.2% |
| 117 | KM543184 | Choristoneura conflictana voucher BIOUG03017-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 95.9% | 862.776 | 0.00e+00 | 92.2% |
| 118 | KM552491 | Choristoneura occidentalis voucher 08BBLEP-04511 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 95.9% | 862.776 | 0.00e+00 | 92.2% |
| 119 | KR940009 | Choristoneura conflictana voucher BIOUG18440-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 860.794 | 0.00e+00 | 92.2% |
| 120 | KM541435 | Choristoneura conflictana voucher BIOUG03754-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 860.794 | 0.00e+00 | 92.2% |
| 121 | KM552988 | Choristoneura conflictana voucher BIOUG04566-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 95.6% | 858.812 | 0.00e+00 | 92.2% |
| 122 | GU096709 | Choristoneura fumiferana voucher BIOUG| 629 |
95.6% |
858.812 |
0.00e+00 |
92.2% |
|
| 123 | KR936465 | Choristoneura conflictana voucher BIOUG18093-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 95.3% | 854.847 | 0.00e+00 | 92.2% |
| 124 | KM542160 | Choristoneura conflictana voucher BIOUG03754-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 619 | 94.1% | 846.918 | 0.00e+00 | 92.2% |
| 125 | MN565334 | Clepsis pallidana isolate 20160111 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 615 | 93.5% | 838.989 | 0.00e+00 | 92.2% |
| 126 | KM543386 | Choristoneura conflictana voucher BIOUG03754-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 93.5% | 838.989 | 0.00e+00 | 92.2% |
| 127 | KM541143 | Choristoneura conflictana voucher BIOUG03957-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 93.3% | 837.007 | 0.00e+00 | 92.2% |
| 128 | HQ936387 | Lepidoptera sp. BOLD:AAA1008 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 894.493 | 0.00e+00 | 92.1% |
| 129 | KT135471 | Choristoneura fractivittana voucher 08BBLEP-00133 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 130 | HM388098 | Choristoneura houstonana voucher BIOUG| 658 |
100.0% |
892.51 |
0.00e+00 |
92.1% |
|
| 131 | MT711512 | Choristoneura diversana haplotype Gene COI cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 132 | KP850093 | Tortricidae sp. BOLD:AAF9350 voucher USNM ENT 00726995 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 133 | JF847027 | Choristoneura houstonana voucher BIOUG| 658 |
100.0% |
892.51 |
0.00e+00 |
92.1% |
|
| 134 | MT711521 | Choristoneura conflictana haplotype COI cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 135 | MT712855 | Choristoneura jezoensis voucher GF_FS_10995coi cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 136 | PV203872 | Archips crataeganus voucher 2060 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 137 | NC_069231 | Choristoneura metasequoiacola mitochondrion, complete genome | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 138 | PQ298422 | Choristoneura diversana voucher FLMNH:MGCL LEP74575 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 139 | JF703052 | Choristoneura conflictana voucher JDDNA4532 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 140 | GU093105 | Choristoneura conflictana voucher BIOUG| 658 |
100.0% |
892.51 |
0.00e+00 |
92.1% |
|
| 141 | KP850797 | Tortricidae sp. BOLD:ACM3136 voucher USNM ENT 00736857 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 142 | NC_039421 | Choristoneura conflictana mitochondrion, complete genome | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 143 | GU090894 | Archips purpurana voucher BIOUG| 658 |
100.0% |
892.51 |
0.00e+00 |
92.1% |
|
| 144 | JF703037 | Argyrotaenia lautana voucher JDDNA4527 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 892.51 | 0.00e+00 | 92.1% |
| 145 | KT147714 | Archips purpurana voucher BIOUG01292-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 146 | HM866314 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-4365 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 147 | KT146689 | Choristoneura pinus voucher HLC-22242 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 148 | HM223217 | Choristoneura retiniana haplotype oB10 cytochrome oxidase subunit I (COI) gene, complete cds; tRNA-Leu gene, complete sequence; and cytochrome oxidase subunit II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 149 | HM403043 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 150 | KT129042 | Choristoneura occidentalis voucher HLC-23233 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 151 | HQ682796 | Choristoneura occidentalis group sp. JRD-2011 voucher 08-JDWBC-0896 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 152 | L19094 | Choristoneura occidentalis cytochrome oxidase I (COI) gene, complete cds; tRNA-Leu (trnL) gene, complete sequence; and cytochrome oxidase II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 153 | KM542870 | Choristoneura fumiferana voucher 08BBLEP-04881 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 154 | MT711304 | Choristoneura occidentalis voucher GF_FS_bibi10coi cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 155 | HQ682815 | Choristoneura occidentalis group sp. JRD-2011 voucher 08-JDWBC-2778 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 156 | KM553190 | Choristoneura pinus voucher 08BBLEP-04471 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 157 | HM866316 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-4367 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 158 | KM540417 | Choristoneura occidentalis voucher 08BBLEP-04940 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 159 | KT134576 | Choristoneura pinus voucher HLC-20689 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 160 | DQ792589 | Choristoneura retiniana voucher FSb866 cytochrome oxidase subunit I (COI) gene, complete cds; tRNA-Leu gene, complete sequence; and cytochrome oxidase subunit II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 161 | HM866318 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-4369 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 162 | KM541666 | Choristoneura occidentalis voucher 08BBLEP-04933 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 163 | KT134247 | Choristoneura pinus voucher HLC-22693 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 164 | HQ682790 | Choristoneura occidentalis group sp. JRD-2011 voucher 08-JDWBC-1999 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 165 | HQ682802 | Choristoneura occidentalis group sp. JRD-2011 voucher 08-JDWBC-3107 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 166 | GU438753 | Archips purpurana voucher BIOUG| 657 |
99.8% |
890.528 |
0.00e+00 |
92.1% |
|
| 167 | DQ792590 | Choristoneura retiniana voucher FSb817 cytochrome oxidase subunit I (COI) gene, complete cds; tRNA-Leu gene, complete sequence; and cytochrome oxidase subunit II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 168 | KM540672 | Choristoneura occidentalis voucher 08BBLEP-03707 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 169 | KM550589 | Choristoneura lambertiana voucher 08BBLEP-03692 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 170 | FJ412292 | Choristoneura occidentalis voucher UBC-2007-0248 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 171 | DQ792585 | Choristoneura occidentalis voucher FSb367 cytochrome oxidase subunit I (COI) gene, complete cds; tRNA-Leu gene, complete sequence; and cytochrome oxidase subunit II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 890.528 | 0.00e+00 | 92.1% |
| 172 | KT127979 | Choristoneura conflictana voucher MNBTT-1962 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 655 | 99.5% | 886.564 | 0.00e+00 | 92.1% |
| 173 | KM550700 | Choristoneura pinus voucher 10BBCLP-2760 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 882.599 | 0.00e+00 | 92.1% |
| 174 | KT130304 | Choristoneura occidentalis group sp. BOLD-2016 voucher 10BBCLP-2758 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 882.599 | 0.00e+00 | 92.1% |
| 175 | HM866606 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-4633 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 642 | 97.6% | 866.741 | 0.00e+00 | 92.1% |
| 176 | KM552746 | Choristoneura occidentalis voucher 08BBLEP-04928 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 96.4% | 860.794 | 0.00e+00 | 92.1% |
| 177 | KM550977 | Choristoneura conflictana voucher BIOUG03045-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 858.812 | 0.00e+00 | 92.1% |
| 178 | KM547218 | Choristoneura conflictana voucher BIOUG04118-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 858.812 | 0.00e+00 | 92.1% |
| 179 | KM553904 | Choristoneura conflictana voucher BIOUG04118-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 858.812 | 0.00e+00 | 92.1% |
| 180 | KM542466 | Choristoneura conflictana voucher BIOUG03017-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 858.812 | 0.00e+00 | 92.1% |
| 181 | HM415008 | Choristoneura conflictana voucher BIOUG| 633 |
96.2% |
858.812 |
0.00e+00 |
92.1% |
|
| 182 | KM539639 | Choristoneura conflictana voucher BIOUG03023-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 856.83 | 0.00e+00 | 92.1% |
| 183 | KM549220 | Choristoneura pinus voucher 08BBLEP-04449 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 856.83 | 0.00e+00 | 92.1% |
| 184 | KM541702 | Choristoneura conflictana voucher BIOUG03045-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 852.865 | 0.00e+00 | 92.1% |
| 185 | KM542425 | Choristoneura conflictana voucher BIOUG03754-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 852.865 | 0.00e+00 | 92.1% |
| 186 | KT147347 | Choristoneura conflictana voucher 08BBLEP-00898 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 94.8% | 848.901 | 0.00e+00 | 92.1% |
| 187 | KT141706 | Choristoneura conflictana voucher BIOUG17538-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 94.4% | 842.954 | 0.00e+00 | 92.1% |
| 188 | HQ930432 | Choristoneura conflictana voucher BIOUG| 620 |
94.2% |
840.972 |
0.00e+00 |
92.1% |
|
| 189 | KM545464 | Choristoneura occidentalis voucher 08BBLEP-03357 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 97.3% | 864.759 | 0.00e+00 | 92.0% |
| 190 | KM541297 | Choristoneura conflictana voucher BIOUG03045-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 97.0% | 860.794 | 0.00e+00 | 92.0% |
| 191 | HM416153 | Archips purpurana voucher BIOUG| 636 |
96.7% |
856.83 |
0.00e+00 |
92.0% |
|
| 192 | GU802001 | Choristoneura obsoletana voucher BIOUG| 636 |
96.7% |
856.83 |
0.00e+00 |
92.0% |
|
| 193 | KM552227 | Choristoneura conflictana voucher BIOUG03754-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 95.3% | 846.918 | 0.00e+00 | 92.0% |
| 194 | KM541852 | Choristoneura conflictana voucher BIOUG03045-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 95.1% | 844.936 | 0.00e+00 | 92.0% |
| 195 | KT146743 | Archips purpurana voucher BIOUG02385-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 94.7% | 838.989 | 0.00e+00 | 92.0% |
| 196 | MG948541 | Choristoneura occidentalis mitochondrion, complete genome | 657 | 99.8% | 894.493 | 0.00e+00 | 91.9% |
| 197 | MT711303 | Choristoneura occidentalis voucher GF_FS_3634coi cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 894.493 | 0.00e+00 | 91.9% |
| 198 | KT127997 | Choristoneura conflictana voucher MNBTT-1957 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 886.564 | 0.00e+00 | 91.9% |
| 199 | GU095662 | Choristoneura conflictana voucher jflandry0634 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 886.564 | 0.00e+00 | 91.9% |
| 200 | KT141361 | Choristoneura conflictana voucher MNBTT-1955 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 201 | KM541811 | Choristoneura conflictana voucher 08BBLEP-01154 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 202 | KM546243 | Archips purpurana voucher 10BBCLP-1918 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 203 | HM427345 | Choristoneura houstonana voucher BIOUG| 658 |
100.0% |
884.581 |
0.00e+00 |
91.9% |
|
| 204 | KT126842 | Choristoneura fractivittana voucher 08BBLEP-00128 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 205 | MT711519 | Choristoneura carnana voucher Sperling lab #7486b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 884.581 | 0.00e+00 | 91.9% |
| 206 | GU694421 | Choristoneura fractivittana voucher BIOUG| 658 |
100.0% |
884.581 |
0.00e+00 |
91.9% |
|
| 207 | KM547658 | Choristoneura conflictana voucher 08BBLEP-01189 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 208 | JF842868 | Choristoneura conflictana voucher BIOUG| 658 |
100.0% |
884.581 |
0.00e+00 |
91.9% |
|
| 209 | MT711513 | Choristoneura diversana haplotype Gene COI cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 210 | KY020385 | Choristoneura parallela voucher H7133 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 211 | KM551220 | Choristoneura conflictana voucher 08BBLEP-01188 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 212 | JF842448 | Choristoneura conflictana voucher BIOUG| 658 |
100.0% |
884.581 |
0.00e+00 |
91.9% |
|
| 213 | HM428337 | Choristoneura houstonana voucher BIOUG| 658 |
100.0% |
884.581 |
0.00e+00 |
91.9% |
|
| 214 | GU706578 | Choristoneura diversana voucher BC ZSM Lep 23425 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 215 | GU090895 | Archips purpurana voucher BIOUG| 658 |
100.0% |
884.581 |
0.00e+00 |
91.9% |
|
| 216 | HM902002 | Lepidoptera sp. BOLD:AAB9404 voucher BC ZSM Lep 23125 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 217 | GU089661 | Archips purpurana voucher DNA-ATBI-0113 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 218 | KT125867 | Choristoneura fractivittana voucher 08BBLEP-00042 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 219 | GU088309 | Choristoneura fractivittana voucher DNA-ATBI-3098 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 220 | NC_037396 | Choristoneura murinana mitochondrion, complete genome | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 221 | MT711507 | Choristoneura murinana voucher Sperling lab #10188 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 222 | KM547057 | Choristoneura parallela voucher 08BBLEP-01767 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 223 | KM552890 | Choristoneura conflictana voucher 08BBLEP-01052 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 224 | KM545890 | Choristoneura conflictana voucher 08BBLEP-01062 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 225 | KM541269 | Choristoneura pinus voucher 08BBLEP-04299 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 884.581 | 0.00e+00 | 91.9% |
| 226 | KM543230 | Archips purpurana voucher 08BBLEP-05608 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 884.581 | 0.00e+00 | 91.9% |
| 227 | JF844406 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 228 | KM551598 | Choristoneura occidentalis voucher 08BBLEP-02303 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 229 | FJ412294 | Choristoneura occidentalis voucher UBC-2007-0246 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 230 | JF842879 | Choristoneura pinus voucher BIOUG| 657 |
99.8% |
882.599 |
0.00e+00 |
91.9% |
|
| 231 | KM544248 | Choristoneura occidentalis voucher 08BBLEP-02412 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 232 | HM403584 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 233 | KF808362 | Lepidoptera sp. BOLD:ABV2389 voucher KJ956 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 234 | KT140304 | Choristoneura pinus voucher HLC-21058 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 235 | HQ963822 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 236 | KM543830 | Choristoneura pinus voucher 08BBLEP-04918 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 237 | KT125552 | Archips purpurana voucher BIOUG01292-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 238 | KF492311 | Cudonigera houstonana voucher AYK-06-7157 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 239 | HM865079 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-3237 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 882.599 | 0.00e+00 | 91.9% |
| 240 | KT139922 | Archips purpurana voucher 2006-ONT-0794 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 880.617 | 0.00e+00 | 91.9% |
| 241 | KM540824 | Choristoneura pinus voucher 08BBLEP-04486 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 642 | 97.6% | 860.794 | 0.00e+00 | 91.9% |
| 242 | HM866605 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-4632 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 642 | 97.6% | 858.812 | 0.00e+00 | 91.9% |
| 243 | KM542355 | Choristoneura conflictana voucher BIOUG07188-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 852.865 | 0.00e+00 | 91.9% |
| 244 | KJ444199 | Archips purpurana voucher BIOUG03683-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 850.883 | 0.00e+00 | 91.9% |
| 245 | KM552226 | Choristoneura sp. BOLD:ABX5883 voucher BIOUG03504-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 848.901 | 0.00e+00 | 91.9% |
| 246 | KM552121 | Choristoneura occidentalis voucher 08BBLEP-04529 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 848.901 | 0.00e+00 | 91.9% |
| 247 | KM543241 | Choristoneura conflictana voucher BIOUG03045-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 848.901 | 0.00e+00 | 91.9% |
| 248 | MG469846 | Choristoneura sp. BIOUG19807-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 848.901 | 0.00e+00 | 91.9% |
| 249 | KM540592 | Choristoneura conflictana voucher BIOUG07188-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 846.918 | 0.00e+00 | 91.9% |
| 250 | KM549690 | Choristoneura conflictana voucher BIOUG07188-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 94.4% | 838.989 | 0.00e+00 | 91.9% |
| 251 | JF703056 | Choristoneura zapulata voucher JDDNA4533 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 880.617 | 0.00e+00 | 91.8% |
| 252 | MT712854 | Choristoneura jezoensis voucher GF_FS_10993coi cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 99.7% | 878.635 | 0.00e+00 | 91.8% |
| 253 | GU092270 | Choristoneura fractivittana voucher BIOUG| 658 |
100.0% |
878.635 |
0.00e+00 |
91.8% |
|
| 254 | JF859741 | Choristoneura murinana voucher TLMF Lep 02157 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 878.635 | 0.00e+00 | 91.8% |
| 255 | KX046387 | Archips rosana voucher BC ZSM Lep 64380 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 256 | OQ182931 | Archips rosana voucher KLM Lep 14903 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 257 | MH417954 | Tortricinae sp. DL14M1-0074 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 258 | KM549347 | Xenotemna pallorana voucher 08BBLEP-00766 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 259 | GU093107 | Choristoneura fractivittana voucher BIOUG| 658 |
100.0% |
876.652 |
0.00e+00 |
91.8% |
|
| 260 | GU095666 | Choristoneura fractivittana voucher jflandry0444 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 261 | KT131712 | Choristoneura fractivittana voucher 08BBLEP-00083 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 262 | HM396364 | Choristoneura albaniana voucher MM00085 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 263 | GU694239 | Choristoneura fractivittana voucher BIOUG| 658 |
100.0% |
876.652 |
0.00e+00 |
91.8% |
|
| 264 | KM551645 | Choristoneura pinus voucher 08BBLEP-04268 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 876.652 | 0.00e+00 | 91.8% |
| 265 | MT712790 | Choristoneura simonyi voucher Sperling lab #7479 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 266 | GU707055 | Archips rosana voucher BC ZSM Lep 25709 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 267 | KM550461 | Archips purpurana voucher 10BBCLP-1919 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 268 | MH417631 | Tortricinae sp. DL14Z1-0026 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 269 | JF703028 | Archips rosana voucher JDDNA4563 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 270 | MT711508 | Choristoneura diversana haplotype Gene COI cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 271 | GU093679 | Xenotemna pallorana voucher BIOUG| 658 |
100.0% |
876.652 |
0.00e+00 |
91.8% |
|
| 272 | KM547195 | Choristoneura pinus voucher 08BBLEP-04283 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 876.652 | 0.00e+00 | 91.8% |
| 273 | MH416212 | Tortricinae sp. DL14Z1-0027 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 274 | MZ607857 | Archips rosana voucher MM24348 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 876.652 | 0.00e+00 | 91.8% |
| 275 | HM865074 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-3232 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 276 | KT133369 | Choristoneura fractivittana voucher PPBP-2407 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 277 | HM403279 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 278 | DQ792587 | Choristoneura biennis voucher FSb53 cytochrome oxidase subunit I (COI) gene, complete cds; tRNA-Leu gene, complete sequence; and cytochrome oxidase subunit II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 279 | GU652741 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 280 | HM865414 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-3541 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 281 | KM545667 | Choristoneura pinus voucher 08BBLEP-04281 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 282 | HM865408 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-3536 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 283 | KT132508 | Choristoneura pinus voucher HLC-22504 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 284 | HM403353 | Lepidoptera sp. BOLD:AAA4026 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 285 | FJ412297 | Choristoneura occidentalis voucher UBC-2007-0921 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 286 | KF492052 | Pseudatteria sp. BOLD:AAW0043 voucher 06-srnp-2203 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 287 | KT132953 | Choristoneura pinus voucher HLC-22697 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 288 | HQ682812 | Choristoneura occidentalis group sp. JRD-2011 voucher 08-JDWBC-2798 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 289 | HM865096 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-3252 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 290 | KF808412 | Lepidoptera sp. BOLD:ABV2389 voucher KJ992.2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 874.67 | 0.00e+00 | 91.8% |
| 291 | KT143330 | Choristoneura fractivittana voucher PPBP-2172 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 872.688 | 0.00e+00 | 91.8% |
| 292 | HM404010 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 644 | 97.9% | 856.83 | 0.00e+00 | 91.8% |
| 293 | KM554671 | Choristoneura sp. BOLD:ABX5883 voucher BIOUG03504-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 637 | 96.8% | 850.883 | 0.00e+00 | 91.8% |
| 294 | KX046736 | Archips rosana voucher BC ZSM Lep add 0045 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 96.7% | 848.901 | 0.00e+00 | 91.8% |
| 295 | HM865985 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-4063 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 635 | 96.5% | 846.918 | 0.00e+00 | 91.8% |
| 296 | KM540516 | Choristoneura pinus voucher 08BBLEP-04488 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 96.4% | 844.936 | 0.00e+00 | 91.8% |
| 297 | KT140719 | Choristoneura fractivittana voucher PPBP-2140 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 96.4% | 844.936 | 0.00e+00 | 91.8% |
| 298 | KM551379 | Choristoneura pinus voucher 08BBLEP-04455 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 653 | 99.2% | 866.741 | 0.00e+00 | 91.7% |
| 299 | HM402009 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 98.9% | 862.776 | 0.00e+00 | 91.7% |
| 300 | KP850958 | Cryptophlebia sp. BOLD:ACL3303 voucher USNM ENT 00792972 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 98.9% | 862.776 | 0.00e+00 | 91.7% |
| 301 | MF049752 | Archips crataeganus isolate DLS110709.129 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 650 | 98.8% | 860.794 | 0.00e+00 | 91.7% |
| 302 | KM543573 | Choristoneura pinus voucher 08BBLEP-04496 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 642 | 97.6% | 854.847 | 0.00e+00 | 91.7% |
| 303 | MG365297 | Archips purpurana voucher BIOUG24088-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 642 | 97.6% | 852.865 | 0.00e+00 | 91.7% |
| 304 | KT131662 | Choristoneura fractivittana voucher PPBP-2142 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 837.007 | 0.00e+00 | 91.7% |
| 305 | KM543841 | Choristoneura pinus voucher 08BBLEP-04307 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 872.688 | 0.00e+00 | 91.6% |
| 306 | GU095665 | Choristoneura fractivittana voucher jflandry0413 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 307 | HM906279 | Homona auriga voucher USNM:00704498 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 308 | KT129649 | Choristoneura fractivittana voucher 08BBLEP-00080 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 309 | GU096211 | Archips purpurana voucher jflandry1066 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 310 | HQ985398 | Archips georgiana voucher BIOUG| 658 |
100.0% |
868.723 |
0.00e+00 |
91.6% |
|
| 311 | OQ564212 | Archips rosana voucher INV00879 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 312 | KT144833 | Xenotemna pallorana voucher 2006-ONT-1209 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 313 | JF703093 | Xenotemna pallorana voucher JDDNA4547 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 314 | MH416671 | Tortricinae sp. DL14M1-0071 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 315 | JF841698 | Archips purpurana voucher BIOUG| 658 |
100.0% |
868.723 |
0.00e+00 |
91.6% |
|
| 316 | JF703069 | Cudonigera houstonana voucher JDDNA4546 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 317 | KF405733 | Planostocha sp. ANIC1 voucher 11ANIC-11598 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 318 | JF703054 | Choristoneura parallela voucher JDDNA2941 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 319 | KY020386 | Choristoneura parallela voucher H7134 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 320 | MH416900 | Tortricinae sp. BKR0190 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 321 | MT711511 | Choristoneura houstonana voucher Sperling lab #10142 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 322 | GU095664 | Choristoneura fractivittana voucher jflandry0446 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 323 | GU089610 | Adoxophyes furcatana voucher DNA-ATBI-0116 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 868.723 | 0.00e+00 | 91.6% |
| 324 | HQ934536 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 866.741 | 0.00e+00 | 91.6% |
| 325 | KF396209 | Sorolopha leptochlora voucher 11ANIC-11879 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 866.741 | 0.00e+00 | 91.6% |
| 326 | HM411183 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 866.741 | 0.00e+00 | 91.6% |
| 327 | HQ964154 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 866.741 | 0.00e+00 | 91.6% |
| 328 | JF843686 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 866.741 | 0.00e+00 | 91.6% |
| 329 | KX861197 | Archips sp. PK04 voucher NIBGE MOT-03223 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 866.741 | 0.00e+00 | 91.6% |
| 330 | HQ936436 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 866.741 | 0.00e+00 | 91.6% |
| 331 | HM403931 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 866.741 | 0.00e+00 | 91.6% |
| 332 | HQ555776 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 866.741 | 0.00e+00 | 91.6% |
| 333 | KF400660 | Homona trachyptera voucher 11ANIC-10968 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 864.759 | 0.00e+00 | 91.6% |
| 334 | JN287540 | Synemon austera voucher 11ANIC-14948 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 860.794 | 0.00e+00 | 91.6% |
| 335 | JF854249 | Archips rosana voucher MM18256 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 98.0% | 850.883 | 0.00e+00 | 91.6% |
| 336 | HM874607 | Archips rosana voucher MM10167 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 96.4% | 837.007 | 0.00e+00 | 91.6% |
| 337 | MT256798 | Isotenes sp. ADC0762 voucher USNM:ENT:01016380 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 862.776 | 0.00e+00 | 91.5% |
| 338 | KF400150 | Isotenes miserana voucher 11ANIC-11594 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 860.794 | 0.00e+00 | 91.5% |
| 339 | HQ552838 | Archips argyrospila voucher BIOUG| 658 |
100.0% |
860.794 |
0.00e+00 |
91.5% |
|
| 340 | MG365329 | Archips sp. BIOUG22549-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 860.794 | 0.00e+00 | 91.5% |
| 341 | HM427863 | Archips semiferana voucher BIOUG| 658 |
100.0% |
860.794 |
0.00e+00 |
91.5% |
|
| 342 | EF070783 | Homona mermerodes voucher BIOUG| 658 |
100.0% |
860.794 |
0.00e+00 |
91.5% |
|
| 343 | KT136127 | Archips purpurana voucher MNBTT-095 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 860.794 | 0.00e+00 | 91.5% |
| 344 | GU688798 | Adoxophyes sp. ANIC3 voucher ANIC Gen No. 003358 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 860.794 | 0.00e+00 | 91.5% |
| 345 | KT139065 | Xenotemna pallorana voucher CGWC-2356 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 860.794 | 0.00e+00 | 91.5% |
| 346 | GU088567 | Adoxophyes furcatana voucher BIOUG| 658 |
100.0% |
860.794 |
0.00e+00 |
91.5% |
|
| 347 | KF402639 | Acropolitis rudisana voucher 11ANIC-10253 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 860.794 | 0.00e+00 | 91.5% |
| 348 | HM863963 | Archips grisea voucher 10-JDWBC-2215 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 860.794 | 0.00e+00 | 91.5% |
| 349 | KP850263 | Tortricidae sp. BOLD:ACO0554 voucher USNM ENT 00739297 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 860.794 | 0.00e+00 | 91.5% |
| 350 | DQ792588 | Choristoneura retiniana voucher FSb816 cytochrome oxidase subunit I (COI) gene, complete cds; tRNA-Leu gene, complete sequence; and cytochrome oxidase subunit II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 351 | MT711306 | Choristoneura lambertiana voucher GF_FS_7472coi cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 352 | JF860242 | Clepsis rogana voucher TLMF Lep 02718 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 353 | GU699308 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 354 | HM223218 | Choristoneura retiniana haplotype bB8 cytochrome oxidase subunit I (COI) gene, complete cds; tRNA-Leu gene, complete sequence; and cytochrome oxidase subunit II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 355 | HM422178 | Clepsis pallidana voucher BC ZSM Lep 25792 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 356 | KF401080 | Arotrophora cosmoplaca voucher 11ANIC-10203 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 357 | HM865075 | Choristoneura occidentalis group sp. BOLD:AAA1517 voucher 10-JDWBC-3233 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 358 | PP483666 | Lepidoptera sp. isolate BBTH357 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 359 | MW596789 | Clepsis pallidana isolate FrCleme09 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 360 | NC_037394 | Choristoneura biennis mitochondrion, complete genome | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 361 | OQ836384 | Lozotaenia capensana voucher TMG912 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 362 | HQ682817 | Choristoneura occidentalis group sp. JRD-2011 voucher 08-JDWBC-2779 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 363 | MH416791 | Tortricinae sp. DL14A1-0234 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 364 | L19096 | Choristoneura biennis cytochrome oxidase I (COI) gene, complete cds; tRNA-Leu (trnL) gene, complete sequence; and cytochrome oxidase II (COII) gene, complete cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 365 | GU698028 | Lepidoptera sp. BOLD:AAA4029 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 366 | MH416193 | Tortricinae sp. DL14M1-0003 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 367 | HQ581287 | Platynota sp. TAMIC342-10 voucher TAMUICEGR-0342 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 858.812 | 0.00e+00 | 91.5% |
| 368 | EF070843 | Homona trachyptera voucher PNG-206033 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 856.83 | 0.00e+00 | 91.5% |
| 369 | KT136901 | Choristoneura albaniana voucher 07PROBE-10141 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 856.83 | 0.00e+00 | 91.5% |
| 370 | EF070842 | Homona trachyptera voucher PNG-3019 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 856.83 | 0.00e+00 | 91.5% |
| 371 | JN287538 | Synemon austera voucher 11ANIC-14946 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 852.865 | 0.00e+00 | 91.5% |
| 372 | MF051630 | Choristoneura evanidana isolate SS100718.237 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 848.901 | 0.00e+00 | 91.5% |
| 373 | KT137775 | Choristoneura albaniana voucher 07PROBE-03949 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 98.0% | 842.954 | 0.00e+00 | 91.5% |
| 374 | KT134462 | Xenotemna pallorana voucher AVBC 1029-11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 644 | 97.9% | 838.989 | 0.00e+00 | 91.5% |
| 375 | KF405223 | Capua deuterastis voucher 11ANIC-10026 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.4% |
| 376 | MF051523 | Choristoneura evanidana isolate SS100718.073 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 850.883 | 0.00e+00 | 91.4% |
| 377 | JF703014 | Adoxophyes negundana voucher JDDNA4567 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 854.847 | 0.00e+00 | 91.3% |
| 378 | HM427395 | Archips semiferana voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 379 | KM573536 | Archips rosana voucher TLMF Lep 08262 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 380 | GU096697 | Choristoneura albaniana voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 381 | GU090981 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 382 | KF397007 | Arotrophora chionaula voucher 11ANIC-08730 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 383 | KP850042 | Tortricidae sp. BOLD:ACO0554 voucher USNM ENT 00739335 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 384 | GU694367 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 385 | GU092275 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 386 | KP849962 | Tortricidae sp. BOLD:AAM7269 voucher USNM ENT 00739527 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 387 | HM884481 | Lepidoptera sp. BOLD:AAH5531 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 388 | GU800384 | Archips argyrospila voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 389 | OQ563464 | Archips rosana voucher INV03160 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 390 | HM415704 | Archips argyrospila voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 391 | HM426615 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 392 | KT128165 | Choristoneura rosaceana voucher MNBTT-2183 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 393 | JF703050 | Choristoneura albaniana voucher JDDNA2948 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 394 | JF703022 | Archips eleagnana voucher JDDNA2914 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 395 | KF396687 | Arotrophora chionaula voucher 11ANIC-10057 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 396 | EF070825 | Homona auriga voucher PNG-203683 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 397 | KM572636 | Archips rosana voucher TLMF Lep 08029 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 398 | HM427297 | Archips semiferana voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 399 | GU092194 | Adoxophyes negundana voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 400 | KT125454 | Choristoneura rosaceana voucher BIOUG01486-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 401 | GU698930 | Lepidoptera sp. BOLD:AAH5531 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 402 | EF070771 | Homona mermerodes voucher USNM 196571 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 852.865 | 0.00e+00 | 91.3% |
| 403 | HM426587 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
852.865 |
0.00e+00 |
91.3% |
|
| 404 | KT128392 | Choristoneura albaniana voucher 07PROBE-03944 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 852.865 | 0.00e+00 | 91.3% |
| 405 | OQ182554 | Clepsis rogana voucher KLM Lep 15493 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 406 | HQ936050 | Lepidoptera sp. BOLD:AAA1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 407 | JF703027 | Archips purpurana voucher JDDNA6306 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 654 | 99.4% | 850.883 | 0.00e+00 | 91.3% |
| 408 | HM409992 | Lepidoptera sp. BOLD:AAA4029 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 409 | GU707285 | Cochylimorpha hilarana voucher BC ZSM Lep 28683 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 410 | MH418389 | Olethreutinae sp. KLM Lep 02307 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 411 | JN286437 | Clepsis rogana voucher MM17738 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 412 | KT129662 | Choristoneura albaniana voucher 07PROBE-10156 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 413 | HM410493 | Lepidoptera sp. BOLD:AAA4029 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 414 | HM401631 | Lepidoptera sp. BOLD:AAA4029 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 415 | GU095459 | Adoxophyes negundana voucher jflandry0605 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 416 | KX049132 | Pandemis dumetana voucher NHMO-06154 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 850.883 | 0.00e+00 | 91.3% |
| 417 | HQ558299 | Homona trachyptera voucher USNM:ENT 00704460 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 848.901 | 0.00e+00 | 91.3% |
| 418 | EF070844 | Homona trachyptera voucher PNG-2290 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 848.901 | 0.00e+00 | 91.3% |
| 419 | JN287539 | Synemon austera voucher 11ANIC-14947 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 844.936 | 0.00e+00 | 91.3% |
| 420 | KT143685 | Choristoneura albaniana voucher 07PROBE-00059 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 844.936 | 0.00e+00 | 91.3% |
| 421 | JF853825 | Clepsis rogana voucher MM17414 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 846.918 | 0.00e+00 | 91.2% |
| 422 | KF404755 | Capua deuterastis voucher 11ANIC-10031 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 846.918 | 0.00e+00 | 91.2% |
| 423 | GU801087 | Archips semiferana voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 424 | JF853823 | Clepsis rogana voucher MM17412 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 844.936 | 0.00e+00 | 91.2% |
| 425 | HM427043 | Archips argyrospila voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 426 | GU090987 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 427 | KF400103 | Isotenes miserana voucher 11ANIC-11596 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 428 | MT711517 | Choristoneura rosaceana voucher Sperling lab #10081 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 429 | GU096718 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 430 | KM572398 | Pandemis dumetana voucher TLMF Lep 08419 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 431 | HM426914 | Archips argyrospila voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 432 | KF399068 | Homona mermerodes voucher 11ANIC-10960 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 433 | KF404142 | Acropolitis rudisana voucher 11ANIC-10254 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 434 | GU091586 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 435 | GU093112 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 436 | NC_037397 | Choristoneura rosaceana mitochondrion, complete genome | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 437 | HM426980 | Archips argyrospila voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 438 | KF402431 | Conchylis vacuana voucher 11ANIC-09100 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 439 | EF070772 | Homona mermerodes voucher USNM 196566 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 440 | GU696673 | Lepidoptera sp. BOLD:AAH5531 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 441 | HM375656 | Lozotaenia costinotana voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 442 | HM427761 | Archips grisea voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 443 | GU706687 | Pandemis dumetana voucher BC ZSM Lep 25138 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 444 | HM426986 | Archips grisea voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 445 | JF703055 | Choristoneura rosaceana voucher JDDNA2937 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 446 | GU090368 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 447 | HM427367 | Archips semiferana voucher BIOUG| 658 |
100.0% |
844.936 |
0.00e+00 |
91.2% |
|
| 448 | GU688784 | Conchylis vacuana voucher ANIC Gen No. 003387 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 449 | KT134877 | Choristoneura rosaceana voucher MNBTT-2389 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 450 | JF703079 | Lozotaenia hesperia voucher JDDNA2949 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 844.936 | 0.00e+00 | 91.2% |
| 451 | GU706859 | Cochylimorpha hilarana voucher BC ZSM Lep 25338 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 452 | KF808441 | Lepidoptera sp. BOLD:ABV2389 voucher KJ931 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 453 | OQ563205 | Lozotaenia cupidinana voucher INV01309 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 454 | JF853936 | Clepsis rogana voucher MM17742 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 455 | HQ106927 | Choristoneura rosaceana voucher EE-1095-88 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 456 | KJ592330 | Archips occidentalis voucher USNM:ENT:00719890 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 457 | HQ106932 | Choristoneura rosaceana voucher EE-156-88 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 458 | MT256619 | Tortricidae sp. BOLD:ADX2362 voucher USNM:ENT:01012370 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 459 | HQ934401 | Lepidoptera sp. BOLD:AAD8772 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 460 | JF853824 | Clepsis rogana voucher MM17413 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 461 | KX863112 | Archips sp. PK03 voucher NIBGE MOT-03225 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 462 | MT682671 | Archips occidentalis voucher Sperling lab #10113 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 463 | HQ581288 | Platynota sp. TAMIC343-10 voucher TAMUICEGR-0343 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 464 | GU095671 | Choristoneura rosaceana voucher jflandry0581 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 465 | JF853914 | Clepsis pallidana voucher MM17583 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 466 | HQ990798 | Archips sp. PK04 voucher NIBGE MOT-00078 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 467 | GU695632 | Cydia sp. BOLD:AAI5719 voucher USNMENT00667876 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 468 | OQ562436 | Lozotaenia cupidinana voucher INV02892 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 469 | KT782405 | Archips betulanus voucher MM19242 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 470 | KF401502 | Anisogona placoxantha voucher 11ANIC-10166 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 471 | JN295954 | Lepidoptera sp. BOLD:AAD8772 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 472 | JF729560 | Lepidoptera sp. 141 PS-2011 voucher Eo00666 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 473 | KP253546 | Aphelia unitana voucher TLMF Lep 07685 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 474 | OQ182011 | Clepsis rogana voucher KLM Lep 15680 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 475 | KF398659 | Asaphistis protosema voucher 11ANIC-12074 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 476 | OP575914 | Meiligma sp. GTI-94 mitochondrion, complete genome | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 477 | HM372992 | Eccoptocera australis voucher ANIC Gen No. 003428 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 478 | KT782620 | Clepsis pallidana voucher MM17584 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 842.954 | 0.00e+00 | 91.2% |
| 479 | GU800438 | Sparganothis pulcherrimana voucher BIOUG| 657 |
99.8% |
842.954 |
0.00e+00 |
91.2% |
|
| 480 | KY501270 | Syndemis sp. as02bcrk cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 840.972 | 0.00e+00 | 91.2% |
| 481 | HM385278 | Cenopis saracana voucher 09-JBTOR-1021 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 840.972 | 0.00e+00 | 91.2% |
| 482 | KT133298 | Choristoneura rosaceana voucher MNBTT-2398 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 840.972 | 0.00e+00 | 91.2% |
| 483 | KT782485 | Acleris lorquiniana voucher MM17756 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 837.007 | 0.00e+00 | 91.2% |
| 484 | GU691753 | Lepidoptera sp. BOLD:AAA7035 voucher BIOUG| 658 |
100.0% |
837.007 |
0.00e+00 |
91.0% |
|
| 485 | KT146008 | Choristoneura rosaceana voucher MNBTT-2377 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 486 | GU438805 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
837.007 |
0.00e+00 |
91.0% |
|
| 487 | HM401772 | Lepidoptera sp. BOLD:AAH5531 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 488 | GU090366 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
837.007 |
0.00e+00 |
91.0% |
|
| 489 | JF703084 | Pandemis dumetana voucher JDDNA4553 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 490 | EF070776 | Homona mermerodes voucher USNM 196567 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 491 | KF491555 | Archips issikii voucher AYK-04-5211 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 492 | HM387022 | Lozotaenia forsterana voucher MM09762 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 493 | EF070749 | Homona mermerodes voucher 121024 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 494 | HQ106923 | Choristoneura rosaceana voucher EE-116-88 P1 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 657 | 99.8% | 837.007 | 0.00e+00 | 91.0% |
| 495 | FJ412304 | Choristoneura rosaceana voucher UBC-2007-0477 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 496 | FJ412171 | Argyrotaenia provana voucher UBC-2007-0489 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 497 | KT145068 | Choristoneura rosaceana voucher 10BBCLP-2783 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 498 | EF070756 | Homona mermerodes voucher 106439 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
| 499 | GU090982 | Choristoneura rosaceana voucher BIOUG| 658 |
100.0% |
837.007 |
0.00e+00 |
91.0% |
|
| 500 | KT130941 | Choristoneura albaniana voucher CHU06-COL-306 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 837.007 | 0.00e+00 | 91.0% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Archips machlopis | Did not match any candidate |
Database coverage of Taxon of Interest Archips machlopisThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Archips machlopis
Flag 5.1A:
The reference data supports this taxon well
21 records
There are 21 sequences in the reference database for Archips machlopis at the given locus COI.
Global occurrence records for Archips machlopis.
Database coverage of species in genus Archips
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI Database coverage of species in genus Archips that occur in country of origin Malaysia
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI |
||||||||||
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Candidates
Independent sources
Flag 4B:
Reference sequence sources lack diversity and may therefore be unreliable
Reasoning: Matching sequence records for this species have only 1-5 independent sources
(found 1 sources)
1 Independent Source
The matching reference sequences for this species have been annotated by 1 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| KX861718 | False |
Ashfaq,M. Akhtar,S. Rafi,M.A. Mansoor,S. Hebert,P.D. |
Mapping global biodiversity connections with DNA barcodes: Lepidoptera of Pakistan | PLoS ONE 12 (3), E0174749 (2017) |
| KX861718 | False |
Ashfaq,M. Hebert,P.D.N. Akhtar,S. Rafi,M.A. |
Direct Submission | Submitted (13-SEP-2016) Centre for Biodiversity Genomics, Biodiversity Institute of Ontario, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada |
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |